CDw78 Antibody (1588): sc-73450
- CDw78 Antibody (1588) is a mouse monoclonal IgG1 provided at 200 µg/ml
- raised against leukocytes of human origin
- recommended for detection of CDw78-antigen expressed on human B lymphocytes of human origin by IP, IF and FCM
- available conjugated to either phycoerythrin or FITC for IF, IHC(P) and FCM
- At present, we have not yet completed the identification of the preferred secondary detection reagent(s) for CDw78 Antibody (1588). This work is in progress.
QUICK LINKS
SEE ALSO...
CDw78 Antibody (1588) is a mouse monoclonal IgG1 antibody that detects CDw78 in human samples through immunoprecipitation (IP), immunofluorescence (IF), and flow cytometry (FCM). CDw78 plays a crucial role in the immune response by serving as a cell surface molecule on both mature and immature B cells, which is essential for the proper functioning of MHC class II molecules. These heterodimeric proteins are vital for presenting antigens to CD4+ T cells, thereby facilitating T cell activation and subsequent immune responses. The interaction between CDw78 and MHC-II is particularly important as CDw78 helps define the conformation of MHC-II when bound to peptides that are processed in lysosomal compartments. Notably, CDw78 expression depends on the coexpression of MHC-II and its chaperone chain, highlighting CDw78′s integral role in the antigen presentation pathway. Furthermore, CDw78 is expressed in certain hematological malignancies, including some acute lymphoblastic leukemias and B-cell lymphomas, making anti-CDw78 antibody (1588) a valuable tool for researchers investigating these conditions and immune signaling mechanisms.
Alexa Fluor® is a trademark of Molecular Probes Inc., OR., USA
LI-COR® and Odyssey® are registered trademarks of LI-COR Biosciences
CDw78 Antibody (1588) References:
- Novel B-cell acute lymphoblastic leukemia sister cell lines BALM 19-23 and BALM-26 with interclonal proliferative and phenotypic heterogeneity from a patient with hypercalcemia. | Matsuo, Y., et al. 2002. Hum Cell. 15: 160-70. PMID: 12703546
- Identification of RFLP markers linked to the H1 gene conferring resistance to the potato cyst nematode Globodera rostochiensis. | Pineda, O., et al. 1993. Genome. 36: 152-6. PMID: 18469978
- [Hemoglobin Stanleyville II [alpha78(EF7)Asn --> Lys]. First case described in Spain]. | González, FA., et al. 2008. Med Clin (Barc). 131: 463-5. PMID: 18928738
- Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. | Rizo-de-la-Torre, LC., et al. 2017. Int J Lab Hematol. 39: 539-545. PMID: 28603845
- Molecular pathogenesis of myelodysplastic syndromes with deletion 5q. | Lee, JH., et al. 2019. Eur J Haematol. 102: 203-209. PMID: 30578738
- Cyclodextrin-Based Organic Radical Contrast Agents for in vivo Imaging of Gliomas. | Melone, L., et al. 2020. Chempluschem. 85: 1171-1178. PMID: 32496028
- Investigating the physiological relevance of ex vivo disc organ culture nutrient microenvironments using in silico modeling and experimental validation. | McDonnell, EE. and Buckley, CT. 2021. JOR Spine. 4: e1141. PMID: 34337330
- Pharmacology of gonadotropin releasing hormone: a model regulatory peptide. | Vale, WW., et al. 1981. Adv Biochem Psychopharmacol. 28: 609-25. PMID: 7010948
- Molecular characterization of the pan-B cell antigen CDw78 as a MHC class II molecule by direct expression cloning of the transcription factor CIITA. | Slack, JL., et al. 1995. Int Immunol. 7: 1087-92. PMID: 8527406
Ordering Information
| Product Name | Catalog # | UNIT | Price | Qty | FAVORITES | |
CDw78 Antibody (1588) | sc-73450 | 200 µg/ml | $322.00 | |||
CDw78 Antibody (1588) FITC | sc-73450 FITC | 200 µg/ml | $336.00 | |||
CDw78 Antibody (1588) PE | sc-73450 PE | 200 µg/ml | $349.00 |