CDw78 Antibody (DF1588): sc-66182

CDw78 Antibody (DF1588) is a mouse monoclonal IgG1 antibody that detects CDw78 protein expressed on human B lymphocytes through immunoprecipitation (IP), immunofluorescence (IF), and flow cytometry (FCM). CDw78 (DF1588) antibody is available in non-conjugated and various conjugated forms, including agarose, horseradish peroxidase (HRP), phycoerythrin (PE), fluorescein isothiocyanate (FITC), and multiple Alexa Fluor® conjugates. CDw78 plays a crucial role in immune response by facilitating interaction between T cells and antigen-presenting cells, essential for T cell activation. CDw78 is a cell surface molecule found on both mature and immature B cells, involved in defining a conformation of major histocompatibility complex class II (MHC-II) molecules that present peptides derived from antigens processed in lysosomal compartments. CDw78 expression depends on MHC-II coexpression and its chaperone chain, highlighting its importance in proper immune system functioning. Anti-CDw78 antibody (DF1588) serves as a valuable research tool for studying aggregated fractions of MHC-II, critical for signaling and antigen presentation. CDw78 expression has been observed in certain acute lymphoblastic leukemias, B-cell lymphomas, and some acute non-lymphocytic leukemias, making CDw78 a potential marker for these conditions.

Alexa Fluor^® is a trademark of Molecular Probes Inc., OR., USA

LI-COR^® and Odyssey^® are registered trademarks of LI-COR Biosciences

CDw78 Antibody (DF1588) References:

1. The nature of the subset of MHC class II molecules carrying the CDw78 epitopes.  |  Drbal, K., et al. 1999. Int Immunol. 11: 491-8. PMID: 10323201
2. Tetraspan microdomains distinct from lipid rafts enrich select peptide-MHC class II complexes.  |  Kropshofer, H., et al. 2002. Nat Immunol. 3: 61-8. PMID: 11743588
3. All peptide-MHC complexes are not created equal.  |  Jensen, PE. 2002. Nat Immunol. 3: 14-5. PMID: 11753403
4. Clustering of MHC-peptide complexes prior to their engagement in the immunological synapse: lipid raft and tetraspan microdomains.  |  Vogt, AB., et al. 2002. Immunol Rev. 189: 136-51. PMID: 12445271
5. Novel B-cell acute lymphoblastic leukemia sister cell lines BALM 19-23 and BALM-26 with interclonal proliferative and phenotypic heterogeneity from a patient with hypercalcemia.  |  Matsuo, Y., et al. 2002. Hum Cell. 15: 160-70. PMID: 12703546
6. MHC class II signal transduction in human dendritic cells induced by a natural ligand, the LAG-3 protein (CD223).  |  Andreae, S., et al. 2003. Blood. 102: 2130-7. PMID: 12775570
7. CDw78 defines MHC class II-peptide complexes that require Ii chain-dependent lysosomal trafficking, not localization to a specific tetraspanin membrane microdomain.  |  Poloso, NJ., et al. 2006. J Immunol. 177: 5451-8. PMID: 17015731
8. Age-related changes in human blood lymphocyte subpopulations.  |  Erkeller-Yuksel, FM., et al. 1992. J Pediatr. 120: 216-22. PMID: 1735817
9. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.  |  Rizo-de-la-Torre, LC., et al. 2017. Int J Lab Hematol. 39: 539-545. PMID: 28603845
10. Molecular pathogenesis of myelodysplastic syndromes with deletion 5q.  |  Lee, JH., et al. 2019. Eur J Haematol. 102: 203-209. PMID: 30578738
11. Molecular characterization of the pan-B cell antigen CDw78 as a MHC class II molecule by direct expression cloning of the transcription factor CIITA.  |  Slack, JL., et al. 1995. Int Immunol. 7: 1087-92. PMID: 8527406
12. CDw78--a determinant on a major histocompatibility complex class II subpopulation that can be induced to associate with the cytoskeleton.  |  Rasmussen, AM., et al. 1997. Eur J Immunol. 27: 3206-13. PMID: 9464807

Monoclonal antibodies for mammalian and non-mammalian protein targets represent essentially all targets covered by polyclonal antibodies. Over 8,300 of our antibodies are offered as ImmunoCruz^® conjugates which eliminates the need for a secondary antibody.

Santa Cruz Biotechnology antibodies have over 360,000 research citations. Anti-CDw78 Antibody (DF1588) has 0 citations in a variety of scientific publications.

Primary antibodies like Anti-CDw78 Antibody (DF1588) for mammalian target proteins are recommended for the detection of a range of mammalian species, primarily of mouse, rat and human species. Many mammalian antibodies are also ideal for veterinary research and reactive with ovine, porcine, caprine, feline, canine, bovine and equine protein targets. Santa Cruz Biotechnology primary monoclonal antibodies are suitable for laboratory research applications and are not intended for diagnostic or therapeutic use.

CDw78 Antibody (DF1588) Specifications

Alternate Product Name: CDw78

Product Clone Name: DF1588

Classification: Primary Antibody

Clonality: Monoclonal Antibody

Antibody Isotype: IgG₁

Amino Acids:

Epitope Target: CDw78

Epitope Species: human

Product Reactivity/Detection: CDw78-antigen expressed on human B lymphocytes

Species Reactivity/Detection: human

Additional Mammalian Reactivity: N/A

Additional Non-Mammalian Reactivity: N/A

Applications: IP, IF, FCM

Vialing Information: Each vial contains 200 µg IgG₁ in 1.0 ml of PBS with < 0.1% sodium azide and 0.1% gelatin

Research Citations: 0 citations in various scientific publications

Available Conjugates/Forms for CDw78 Antibody (DF1588): AC: Agarose, AF488: Alexa Fluor^® 488, AF546: Alexa Fluor^® 546, AF594: Alexa Fluor^® 594, AF647: Alexa Fluor^® 647, AF680: Alexa Fluor^® 680, AF790: Alexa Fluor^® 790, FITC: Fluoroscein, HRP: Horseradish Peroxidase, PE: Phycoerythrin