Date published: 2026-8-28

1-800-457-3801

SCBT Portrait Logo
Seach Input

CDw78 Antibody (1588): sc-73450

2.0(1)
Write a reviewAsk a question

Datasheets
  • CDw78 Antibody (1588) is a mouse monoclonal IgG1 provided at 200 µg/ml
  • raised against leukocytes of human origin
  • recommended for detection of CDw78-antigen expressed on human B lymphocytes of human origin by IP, IF and FCM
  • available conjugated to either phycoerythrin or FITC for IF, IHC(P) and FCM
  • At present, we have not yet completed the identification of the preferred secondary detection reagent(s) for CDw78 Antibody (1588). This work is in progress.
    Gene Editing Promo Banner

    QUICK LINKS

    SEE ALSO...

    CDw78 Antibody (1588) is a mouse monoclonal IgG1 antibody that detects CDw78 in human samples through immunoprecipitation (IP), immunofluorescence (IF), and flow cytometry (FCM). CDw78 plays a crucial role in the immune response by serving as a cell surface molecule on both mature and immature B cells, which is essential for the proper functioning of MHC class II molecules. These heterodimeric proteins are vital for presenting antigens to CD4+ T cells, thereby facilitating T cell activation and subsequent immune responses. The interaction between CDw78 and MHC-II is particularly important as CDw78 helps define the conformation of MHC-II when bound to peptides that are processed in lysosomal compartments. Notably, CDw78 expression depends on the coexpression of MHC-II and its chaperone chain, highlighting CDw78′s integral role in the antigen presentation pathway. Furthermore, CDw78 is expressed in certain hematological malignancies, including some acute lymphoblastic leukemias and B-cell lymphomas, making anti-CDw78 antibody (1588) a valuable tool for researchers investigating these conditions and immune signaling mechanisms.

    For Research Use Only. Not Intended for Diagnostic or Therapeutic Use.

    Alexa Fluor® is a trademark of Molecular Probes Inc., OR., USA

    LI-COR® and Odyssey® are registered trademarks of LI-COR Biosciences

    CDw78 Antibody (1588) References:

    1. Novel B-cell acute lymphoblastic leukemia sister cell lines BALM 19-23 and BALM-26 with interclonal proliferative and phenotypic heterogeneity from a patient with hypercalcemia.  |  Matsuo, Y., et al. 2002. Hum Cell. 15: 160-70. PMID: 12703546
    2. Identification of RFLP markers linked to the H1 gene conferring resistance to the potato cyst nematode Globodera rostochiensis.  |  Pineda, O., et al. 1993. Genome. 36: 152-6. PMID: 18469978
    3. [Hemoglobin Stanleyville II [alpha78(EF7)Asn --> Lys]. First case described in Spain].  |  González, FA., et al. 2008. Med Clin (Barc). 131: 463-5. PMID: 18928738
    4. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.  |  Rizo-de-la-Torre, LC., et al. 2017. Int J Lab Hematol. 39: 539-545. PMID: 28603845
    5. Molecular pathogenesis of myelodysplastic syndromes with deletion 5q.  |  Lee, JH., et al. 2019. Eur J Haematol. 102: 203-209. PMID: 30578738
    6. Cyclodextrin-Based Organic Radical Contrast Agents for in vivo Imaging of Gliomas.  |  Melone, L., et al. 2020. Chempluschem. 85: 1171-1178. PMID: 32496028
    7. Investigating the physiological relevance of ex vivo disc organ culture nutrient microenvironments using in silico modeling and experimental validation.  |  McDonnell, EE. and Buckley, CT. 2021. JOR Spine. 4: e1141. PMID: 34337330
    8. Pharmacology of gonadotropin releasing hormone: a model regulatory peptide.  |  Vale, WW., et al. 1981. Adv Biochem Psychopharmacol. 28: 609-25. PMID: 7010948
    9. Molecular characterization of the pan-B cell antigen CDw78 as a MHC class II molecule by direct expression cloning of the transcription factor CIITA.  |  Slack, JL., et al. 1995. Int Immunol. 7: 1087-92. PMID: 8527406

    Ordering Information

    Product NameCatalog #UNITPriceQtyFAVORITES

    CDw78 Antibody (1588)

    sc-73450
    200 µg/ml
    $322.00

    CDw78 Antibody (1588) FITC

    sc-73450 FITC
    200 µg/ml
    $336.00

    CDw78 Antibody (1588) PE

    sc-73450 PE
    200 µg/ml
    $349.00